Transcript: Human XM_017029240.1

PREDICTED: Homo sapiens interleukin 1 receptor accessory protein like 1 (IL1RAPL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL1RAPL1 (11141)
Length:
3585
CDS:
965..3055

Additional Resources:

NCBI RefSeq record:
XM_017029240.1
NBCI Gene record:
IL1RAPL1 (11141)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058793 GCCAGCGTTCTCCTTCATAAA pLKO.1 1997 CDS 100% 13.200 10.560 N IL1RAPL1 n/a
2 TRCN0000058797 GCTGGAAACCAGACTTCGAAA pLKO.1 2437 CDS 100% 4.950 3.960 N IL1RAPL1 n/a
3 TRCN0000058795 CGAAGCTATGAGTACGACGTA pLKO.1 2840 CDS 100% 2.640 2.112 N IL1RAPL1 n/a
4 TRCN0000430733 CAAAGCAAGCGGCTGATTATT pLKO_005 2369 CDS 100% 15.000 10.500 N IL1RAPL1 n/a
5 TRCN0000420751 TCAAGCTCCTGACGGTCATTA pLKO_005 2556 CDS 100% 13.200 9.240 N IL1RAPL1 n/a
6 TRCN0000058796 GCAAAGAAGAAGACTCCATTT pLKO.1 1254 CDS 100% 10.800 7.560 N IL1RAPL1 n/a
7 TRCN0000058794 CCACTTACTGTATGAAAGTAT pLKO.1 1332 CDS 100% 5.625 3.938 N IL1RAPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029240.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.