Transcript: Human XM_017029242.2

PREDICTED: Homo sapiens CHM Rab escort protein (CHM), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHM (1121)
Length:
2950
CDS:
27..1835

Additional Resources:

NCBI RefSeq record:
XM_017029242.2
NBCI Gene record:
CHM (1121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245183 GATTTACCATCCAACGTTTAT pLKO_005 1725 CDS 100% 13.200 18.480 N CHM n/a
2 TRCN0000065182 GATCGTAATAGGGACGGGTTT pLKO.1 59 CDS 100% 4.050 5.670 N CHM n/a
3 TRCN0000065179 CGGTATGGCAACACTCCATTT pLKO.1 1125 CDS 100% 10.800 8.640 N CHM n/a
4 TRCN0000245182 ATGCATGAAAGGCACCTATTT pLKO_005 1520 CDS 100% 13.200 9.240 N CHM n/a
5 TRCN0000245180 CCTACGGAGGATGAGTCATTA pLKO_005 444 CDS 100% 13.200 9.240 N CHM n/a
6 TRCN0000065181 CCAGAGAATGCGCTAGAAGTA pLKO.1 513 CDS 100% 4.950 3.465 N CHM n/a
7 TRCN0000065180 CCATATACTGAAATGGAGATA pLKO.1 1614 CDS 100% 4.950 3.465 N CHM n/a
8 TRCN0000065178 GCCCAGATTGTGGTTTAGGAA pLKO.1 1756 CDS 100% 3.000 2.100 N CHM n/a
9 TRCN0000245181 GGATATGAAGAGATCACATTT pLKO_005 966 CDS 100% 13.200 7.920 N CHM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.