Transcript: Human XM_017029317.1

PREDICTED: Homo sapiens transcription elongation factor A N-terminal and central domain containing (TCEANC), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCEANC (170082)
Length:
3166
CDS:
266..1321

Additional Resources:

NCBI RefSeq record:
XM_017029317.1
NBCI Gene record:
TCEANC (170082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230793 GCCAAGTGTTTGCTATCAAAG pLKO_005 467 CDS 100% 10.800 15.120 N TCEANC n/a
2 TRCN0000230794 AGCGAGGAACAGCCCTAAATT pLKO_005 520 CDS 100% 15.000 12.000 N TCEANC n/a
3 TRCN0000257380 GAGGGAGTGGATGACTATTTA pLKO_005 1492 3UTR 100% 15.000 10.500 N TCEANC n/a
4 TRCN0000230795 CAAATGATGACTTACGTAATT pLKO_005 1250 CDS 100% 13.200 9.240 N TCEANC n/a
5 TRCN0000218011 CAACACCCATGAGAACTAAAT pLKO_005 774 CDS 100% 13.200 9.240 N TCEANC n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 236 5UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 236 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.