Transcript: Human XM_017029493.2

PREDICTED: Homo sapiens shroom family member 2 (SHROOM2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHROOM2 (357)
Length:
5011
CDS:
1150..2505

Additional Resources:

NCBI RefSeq record:
XM_017029493.2
NBCI Gene record:
SHROOM2 (357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162637 CCACCAATTCTACCTACTACA pLKO.1 1832 CDS 100% 4.950 3.960 N SHROOM2 n/a
2 TRCN0000158903 CCCAAGGAATTTCAGAGTATT pLKO.1 4455 3UTR 100% 13.200 9.240 N SHROOM2 n/a
3 TRCN0000160259 CCAGTAGTAATGTGCTTGTTA pLKO.1 3282 3UTR 100% 5.625 3.938 N SHROOM2 n/a
4 TRCN0000160717 CCCACATTCTCTGAACTATCT pLKO.1 622 5UTR 100% 4.950 3.465 N SHROOM2 n/a
5 TRCN0000163225 GAGCGCATCGTCTTTGACATT pLKO.1 2320 CDS 100% 4.950 3.465 N SHROOM2 n/a
6 TRCN0000163258 GCTGGAGAAAGACCAGATCAA pLKO.1 1377 CDS 100% 4.950 3.465 N SHROOM2 n/a
7 TRCN0000162749 CCCAGCAGAAATCATCATCAT pLKO.1 3019 3UTR 100% 4.950 2.970 N SHROOM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.