Transcript: Human XM_017029664.1

PREDICTED: Homo sapiens THO complex 2 (THOC2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THOC2 (57187)
Length:
5908
CDS:
33..5120

Additional Resources:

NCBI RefSeq record:
XM_017029664.1
NBCI Gene record:
THOC2 (57187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230707 GTACAACATTAAACGTGTTTA pLKO_005 5646 3UTR 100% 13.200 18.480 N THOC2 n/a
2 TRCN0000218809 TCAATAGGAAGTGCATCTAAA pLKO_005 3882 CDS 100% 13.200 18.480 N THOC2 n/a
3 TRCN0000011036 GCCAGGGTACTTGGTAAAGAT pLKO.1 4122 CDS 100% 5.625 7.875 N THOC2 n/a
4 TRCN0000006618 GCATAGTGATAGAGCCACATA pLKO.1 3341 CDS 100% 4.950 6.930 N THOC2 n/a
5 TRCN0000230704 CAATGTATGCCCATCATATTT pLKO_005 2641 CDS 100% 15.000 12.000 N THOC2 n/a
6 TRCN0000230706 GCCTTGAAACAGGCGAATATA pLKO_005 3514 CDS 100% 15.000 10.500 N THOC2 n/a
7 TRCN0000230705 TGTATATTTCCTCGATGTATT pLKO_005 3123 CDS 100% 13.200 9.240 N THOC2 n/a
8 TRCN0000006619 GCCACAGCAATCCAACCATTT pLKO.1 1885 CDS 100% 10.800 7.560 N THOC2 n/a
9 TRCN0000006617 CCTCCATTCTTGCTGATGTAT pLKO.1 274 CDS 100% 5.625 3.938 N THOC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.