Transcript: Human XM_017029695.1

PREDICTED: Homo sapiens retrotransposon Gag like 9 (RTL9), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RTL9 (57529)
Length:
6418
CDS:
1251..5417

Additional Resources:

NCBI RefSeq record:
XM_017029695.1
NBCI Gene record:
RTL9 (57529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430702 ACGATGTCCGCAACGCTAATG pLKO_005 1698 CDS 100% 10.800 15.120 N RTL9 n/a
2 TRCN0000141280 CAACAGCCTGTAAGCGGAATA pLKO.1 5227 CDS 100% 10.800 15.120 N RTL9 n/a
3 TRCN0000432984 AGCAATGTCCACACCGCTAAT pLKO_005 2477 CDS 100% 10.800 8.640 N RTL9 n/a
4 TRCN0000141440 CCCTTGTAACCCAGTAGACTT pLKO.1 5852 3UTR 100% 4.950 3.960 N RTL9 n/a
5 TRCN0000428461 GGGTTGTCTGCATCGCTAATG pLKO_005 3243 CDS 100% 10.800 7.560 N RTL9 n/a
6 TRCN0000121733 CACCAGTAAGAGCTTTAGATT pLKO.1 2452 CDS 100% 5.625 3.938 N RTL9 n/a
7 TRCN0000142057 GCACTCTGCTACCTCTTAGAA pLKO.1 4689 CDS 100% 5.625 3.938 N RTL9 n/a
8 TRCN0000141077 CCCAAACCTCTGGATCAACAT pLKO.1 2995 CDS 100% 4.950 3.465 N RTL9 n/a
9 TRCN0000142603 GAAGGCCCATACCAACAAGTA pLKO.1 5396 CDS 100% 4.950 3.465 N RTL9 n/a
10 TRCN0000145356 GATCTGTTGTTTATGGCCTTT pLKO.1 6109 3UTR 100% 4.050 2.835 N RTL9 n/a
11 TRCN0000122817 GCAGACGTACAGATTCTGCAT pLKO.1 1359 CDS 100% 0.264 0.185 N RTL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.