Transcript: Human XM_017029841.1

PREDICTED: Homo sapiens S100 calcium binding protein G (S100G), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
S100G (795)
Length:
926
CDS:
522..761

Additional Resources:

NCBI RefSeq record:
XM_017029841.1
NBCI Gene record:
S100G (795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054084 CCAGTTTACTCAAAGGTCCAA pLKO.1 643 CDS 100% 2.640 3.696 N S100G n/a
2 TRCN0000054086 GTGATCCAGACCAGTTGTCAA pLKO.1 586 CDS 100% 4.950 3.960 N S100G n/a
3 TRCN0000416242 ACCCTAGATGATCTCTTTCAA pLKO_005 666 CDS 100% 5.625 3.938 N S100G n/a
4 TRCN0000054087 ATGGAGATGGAGAAGTTAGTT pLKO.1 700 CDS 100% 5.625 3.938 N S100G n/a
5 TRCN0000054085 CAAAGGATGAACTGAAGCTAT pLKO.1 604 CDS 100% 4.950 3.465 N S100G n/a
6 TRCN0000435580 CCAGTTGTCAAAGGATGAACT pLKO_005 596 CDS 100% 4.950 3.465 N S100G n/a
7 TRCN0000434393 AGAACTGGACAAGAATGGAGA pLKO_005 686 CDS 100% 2.640 1.848 N S100G n/a
8 TRCN0000439596 GCCAAAGAAGGTGATCCAGAC pLKO_005 576 CDS 100% 2.250 1.575 N S100G n/a
9 TRCN0000054083 GCTATTGATTCAGGCTGAATT pLKO.1 620 CDS 100% 0.000 0.000 N S100G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.