Transcript: Human XM_017029915.1

PREDICTED: Homo sapiens cyclin B3 (CCNB3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCNB3 (85417)
Length:
4684
CDS:
259..4473

Additional Resources:

NCBI RefSeq record:
XM_017029915.1
NBCI Gene record:
CCNB3 (85417)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029915.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006459 GCGCAGATATGCTAGGTGTAT pLKO.1 4080 CDS 100% 4.950 6.930 N CCNB3 n/a
2 TRCN0000314749 GCGCAGATATGCTAGGTGTAT pLKO_005 4080 CDS 100% 4.950 6.930 N CCNB3 n/a
3 TRCN0000006462 CTCTACCTAATGAAGGCAGTA pLKO.1 3856 CDS 100% 4.050 5.670 N CCNB3 n/a
4 TRCN0000006458 GCATGTTAACAGGGTATATTT pLKO.1 4496 3UTR 100% 15.000 10.500 N CCNB3 n/a
5 TRCN0000314752 GCATGTTAACAGGGTATATTT pLKO_005 4496 3UTR 100% 15.000 10.500 N CCNB3 n/a
6 TRCN0000314753 AGAATTGCCAAACGAAGATAT pLKO_005 362 CDS 100% 13.200 9.240 N CCNB3 n/a
7 TRCN0000006461 CGTCCTCAAATGTGACATTAA pLKO.1 4035 CDS 100% 13.200 9.240 N CCNB3 n/a
8 TRCN0000314680 CGTCCTCAAATGTGACATTAA pLKO_005 4035 CDS 100% 13.200 9.240 N CCNB3 n/a
9 TRCN0000006460 GTCTTCTTTGAAGTCGCCAAA pLKO.1 4378 CDS 100% 4.050 2.835 N CCNB3 n/a
10 TRCN0000314682 GTCTTCTTTGAAGTCGCCAAA pLKO_005 4378 CDS 100% 4.050 2.835 N CCNB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029915.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.