Transcript: Human XM_017030078.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 9 Y-linked (USP9Y), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP9Y (8287)
Length:
7771
CDS:
86..7768

Additional Resources:

NCBI RefSeq record:
XM_017030078.2
NBCI Gene record:
USP9Y (8287)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017030078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007369 GCTATCCAACTCAAACGATTT pLKO.1 5486 CDS 100% 10.800 15.120 N USP9Y n/a
2 TRCN0000007367 GCGATGTATTGTTAATCGTAT pLKO.1 2851 CDS 100% 4.950 6.930 N USP9Y n/a
3 TRCN0000314653 GCGATGTATTGTTAATCGTAT pLKO_005 2851 CDS 100% 4.950 6.930 N USP9Y n/a
4 TRCN0000007368 GCTCTTACATTACAGGACCTT pLKO.1 1361 CDS 100% 2.640 3.696 N USP9Y n/a
5 TRCN0000007366 CCTCCCAAGTTCTATACCTAA pLKO.1 3357 CDS 100% 4.950 3.960 N USP9Y n/a
6 TRCN0000314727 AGCAAGAGAGAAGGGTAAATA pLKO_005 4198 CDS 100% 15.000 10.500 N USP9Y n/a
7 TRCN0000350384 ATGCTTACAATGGCAATATTA pLKO_005 4260 CDS 100% 15.000 10.500 N USP9Y n/a
8 TRCN0000314655 TAGTGATTTACACGATGATAT pLKO_005 4882 CDS 100% 13.200 9.240 N USP9Y n/a
9 TRCN0000030855 CCAGCCATTGAGAGAAGTGTA pLKO.1 6056 CDS 100% 4.950 2.970 N Usp9y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017030078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.