Transcript: Mouse XM_017312267.1

PREDICTED: Mus musculus zinc finger protein 788 (Zfp788), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp788 (67607)
Length:
3784
CDS:
348..2846

Additional Resources:

NCBI RefSeq record:
XM_017312267.1
NBCI Gene record:
Zfp788 (67607)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095836 CGGGTCCATGAAAGAAACCAT pLKO.1 2295 CDS 100% 3.000 4.200 N Zfp788 n/a
2 TRCN0000095837 CTAGGAGAAGTCAAAGAATAT pLKO.1 427 CDS 100% 13.200 9.240 N Zfp788 n/a
3 TRCN0000095834 GTATGAGTATAAAGTGGGATA pLKO.1 2980 3UTR 100% 4.050 2.835 N Zfp788 n/a
4 TRCN0000095835 CCCTCCTTACTTAAACTGCAT pLKO.1 1779 CDS 100% 2.640 1.848 N Zfp788 n/a
5 TRCN0000095838 CCTATGAATGTAGGCTGTGTA pLKO.1 901 CDS 100% 4.950 2.970 N Zfp788 n/a
6 TRCN0000243739 GAATGTAAACAATGTGGTAAA pLKO_005 1242 CDS 100% 10.800 5.400 Y Gm14411 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.