Transcript: Mouse XM_017312316.1

PREDICTED: Mus musculus tudor domain containing 12 (Tdrd12), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tdrd12 (71981)
Length:
4475
CDS:
292..4023

Additional Resources:

NCBI RefSeq record:
XM_017312316.1
NBCI Gene record:
Tdrd12 (71981)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258096 CATGTGTCAGGACGTAGAAAT pLKO_005 312 CDS 100% 13.200 18.480 N Tdrd12 n/a
2 TRCN0000200705 GACGTAGAAATGAAACCATTA pLKO.1 322 CDS 100% 10.800 15.120 N Tdrd12 n/a
3 TRCN0000250990 AGAGTGTTTCCTGGTCGATTT pLKO_005 447 CDS 100% 10.800 8.640 N Tdrd12 n/a
4 TRCN0000250992 CAGGTTGCTTCTGGGTAATTA pLKO_005 212 5UTR 100% 15.000 10.500 N Tdrd12 n/a
5 TRCN0000190347 CGAGAAGAACGGCTGTGTAAA pLKO.1 1182 CDS 100% 13.200 9.240 N Tdrd12 n/a
6 TRCN0000216432 GTTTACCTTTATGCAACAATA pLKO.1 727 CDS 100% 13.200 9.240 N Tdrd12 n/a
7 TRCN0000250991 GTTTACCTTTATGCAACAATA pLKO_005 727 CDS 100% 13.200 9.240 N Tdrd12 n/a
8 TRCN0000192371 CGGAGAAGTGTACTGAATCTT pLKO.1 1037 CDS 100% 5.625 3.938 N Tdrd12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.