Transcript: Mouse XM_017312324.1

PREDICTED: Mus musculus syntrophin, gamma 1 (Sntg1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sntg1 (71096)
Length:
6606
CDS:
1461..2870

Additional Resources:

NCBI RefSeq record:
XM_017312324.1
NBCI Gene record:
Sntg1 (71096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112972 CCAAGCAATAGCATCTAACAT pLKO.1 2084 CDS 100% 5.625 7.875 N Sntg1 n/a
2 TRCN0000112973 GCAGAACATAACATCCCGGTT pLKO.1 1542 CDS 100% 2.160 3.024 N Sntg1 n/a
3 TRCN0000147410 GAAGCAAAGGAGTTGGAATTT pLKO.1 2703 CDS 100% 13.200 9.240 N SNTG1 n/a
4 TRCN0000112971 GCGGAAACATTGCTTCACTAT pLKO.1 2375 CDS 100% 4.950 3.465 N Sntg1 n/a
5 TRCN0000112970 GCTGTGTTTAATCTTACTGTA pLKO.1 3405 3UTR 100% 4.950 3.465 N Sntg1 n/a
6 TRCN0000112974 GCTTGTTTGGACCCTCTGTTT pLKO.1 2778 CDS 100% 4.950 3.465 N Sntg1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 29 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312324.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.