Transcript: Mouse XM_017312370.1

PREDICTED: Mus musculus aldehyde oxidase 3 (Aox3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aox3 (71724)
Length:
3666
CDS:
103..3438

Additional Resources:

NCBI RefSeq record:
XM_017312370.1
NBCI Gene record:
Aox3 (71724)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076577 CCTCCTTAGGTGGTCATATTA pLKO.1 488 CDS 100% 15.000 21.000 N Aox3 n/a
2 TRCN0000076576 CGGGAAATACAAGATTGGCTT pLKO.1 1974 CDS 100% 2.640 3.696 N Aox3 n/a
3 TRCN0000076574 CCGTGAATTAAAGATACCTAT pLKO.1 2598 CDS 100% 4.950 3.960 N Aox3 n/a
4 TRCN0000076573 CCACAGGTCACAAATATAAAT pLKO.1 3480 3UTR 100% 15.000 10.500 N Aox3 n/a
5 TRCN0000222652 GCCGTGAATTAAAGATACCTA pLKO.1 2597 CDS 100% 3.000 2.100 N Aox3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.