Transcript: Mouse XM_017312480.1

PREDICTED: Mus musculus predicted gene 7207 (Gm7207), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm7207 (637541)
Length:
975
CDS:
1..975

Additional Resources:

NCBI RefSeq record:
XM_017312480.1
NBCI Gene record:
Gm7207 (637541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027592 ACTTGGCTCAGCTCAAGGAAA pLKO.1 209 CDS 100% 4.950 2.970 N LOC381700 n/a
2 TRCN0000027586 GTCCTCTTCAAGTCAGAGATA pLKO.1 253 CDS 100% 4.950 2.970 N LOC381700 n/a
3 TRCN0000027610 GCACCTCCAGTGAGACATATA pLKO.1 770 CDS 100% 13.200 6.600 Y LOC381698 n/a
4 TRCN0000361476 CTTGATCTCCAAGCTTCTTAG pLKO_005 849 CDS 100% 10.800 5.400 Y Aurkc n/a
5 TRCN0000027623 TCATTTCATTGTGGCCCTGAA pLKO.1 231 CDS 100% 4.050 2.025 Y LOC381700 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.