Transcript: Mouse XM_017312617.1

PREDICTED: Mus musculus lysine (K)-specific demethylase 5B (Kdm5b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kdm5b (75605)
Length:
5538
CDS:
319..4398

Additional Resources:

NCBI RefSeq record:
XM_017312617.1
NBCI Gene record:
Kdm5b (75605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363986 ATCGCTTGCTGCACCGTTATT pLKO_005 1697 CDS 100% 13.200 18.480 N Kdm5b n/a
2 TRCN0000113493 CGGCATTCTTTGAGTAGCCTT pLKO.1 2794 CDS 100% 2.640 3.696 N Kdm5b n/a
3 TRCN0000379331 TTTCTGGTAGGCTAGGTTTAT pLKO_005 5453 3UTR 100% 13.200 10.560 N Kdm5b n/a
4 TRCN0000353576 GGACAACAGAACCTCATATTT pLKO_005 3801 CDS 100% 15.000 10.500 N KDM5B n/a
5 TRCN0000348748 TTCGCTTGTGATGTCGATAAA pLKO_005 64 5UTR 100% 13.200 9.240 N Kdm5b n/a
6 TRCN0000375587 TCTACTGATTACGAAGGTATT pLKO_005 5222 3UTR 100% 10.800 7.560 N Kdm5b n/a
7 TRCN0000113494 CCCAGTACATCTCAATTCTTT pLKO.1 2991 CDS 100% 5.625 3.938 N Kdm5b n/a
8 TRCN0000113491 GCCTACATCATGTGAAAGAAT pLKO.1 1988 CDS 100% 5.625 3.938 N Kdm5b n/a
9 TRCN0000335774 GCCTACATCATGTGAAAGAAT pLKO_005 1988 CDS 100% 5.625 3.938 N Kdm5b n/a
10 TRCN0000113490 CGGTGCTATTTCTATTCCTTA pLKO.1 5064 3UTR 100% 4.950 3.465 N Kdm5b n/a
11 TRCN0000113492 CCTGAAATTCAGGAGCTTTAT pLKO.1 3925 CDS 100% 13.200 7.920 N Kdm5b n/a
12 TRCN0000335698 CCTGAAATTCAGGAGCTTTAT pLKO_005 3925 CDS 100% 13.200 7.920 N Kdm5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.