Transcript: Mouse XM_017312713.1

PREDICTED: Mus musculus zinc finger protein 868 (Zfp868), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp868 (234362)
Length:
3658
CDS:
1630..2898

Additional Resources:

NCBI RefSeq record:
XM_017312713.1
NBCI Gene record:
Zfp868 (234362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321698 ATTGAAGAAAGACCGTATAAA pLKO_005 2161 CDS 100% 15.000 21.000 N Zfp868 n/a
2 TRCN0000084844 GCAGACTTACTCACTTGCGAT pLKO.1 2291 CDS 100% 2.640 3.696 N Zfp868 n/a
3 TRCN0000350581 GACTTACTCACTTGCGATTAC pLKO_005 2294 CDS 100% 10.800 8.640 N Zfp868 n/a
4 TRCN0000084843 CCCTTCAACTTCCATACAAAT pLKO.1 3082 3UTR 100% 13.200 9.240 N Zfp868 n/a
5 TRCN0000321635 GAGTTCCTATCATAGACATAA pLKO_005 2382 CDS 100% 13.200 9.240 N Zfp868 n/a
6 TRCN0000084845 GCATGGAGAGACATTCTATAA pLKO.1 2409 CDS 100% 13.200 9.240 N Zfp868 n/a
7 TRCN0000321697 TCAAATGCATGAACGGATTTA pLKO_005 2887 CDS 100% 13.200 9.240 N Zfp868 n/a
8 TRCN0000321636 TTAACTCCAGAGCCCTATAAC pLKO_005 3179 3UTR 100% 13.200 9.240 N Zfp868 n/a
9 TRCN0000084846 AGAGTTCCTATCATAGACATA pLKO.1 2381 CDS 100% 4.950 3.465 N Zfp868 n/a
10 TRCN0000084847 CGATTACATGAGAAAGTTCAT pLKO.1 2308 CDS 100% 4.950 3.465 N Zfp868 n/a
11 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 2246 CDS 100% 5.625 2.813 Y ZNF345 n/a
12 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 2664 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.