Transcript: Mouse XM_017312740.1

PREDICTED: Mus musculus RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing (Rltpr), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Carmil2 (234695)
Length:
4443
CDS:
151..4347

Additional Resources:

NCBI RefSeq record:
XM_017312740.1
NBCI Gene record:
Carmil2 (234695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253287 TTCAGCCCTTAGGTCTGATTT pLKO_005 2156 CDS 100% 13.200 10.560 N Carmil2 n/a
2 TRCN0000253286 AGCAAGAGGAAGCAAAGTAAA pLKO_005 3700 CDS 100% 13.200 9.240 N Carmil2 n/a
3 TRCN0000253290 CAGGCTCTGATGGTGACATTA pLKO_005 3740 CDS 100% 13.200 9.240 N Carmil2 n/a
4 TRCN0000253288 AGAAGCTGGGTACGCTCTTTG pLKO_005 3296 CDS 100% 10.800 7.560 N Carmil2 n/a
5 TRCN0000253289 CATTGGGACAGCAGCTGAATG pLKO_005 3881 CDS 100% 10.800 6.480 N Carmil2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.