Transcript: Mouse XM_017312828.2

PREDICTED: Mus musculus polycystic kidney disease 1 like 3 (Pkd1l3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pkd1l3 (244646)
Length:
6790
CDS:
115..6645

Additional Resources:

NCBI RefSeq record:
XM_017312828.2
NBCI Gene record:
Pkd1l3 (244646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437008 GGATCGCATCCAGGGATAAAT pLKO_005 394 CDS 100% 15.000 21.000 N Pkd1l3 n/a
2 TRCN0000437867 AGGTCAGTGTGGCCAATTTAC pLKO_005 2210 CDS 100% 13.200 18.480 N Pkd1l3 n/a
3 TRCN0000102865 CCACGACTTAATAGAAGATAT pLKO.1 2748 CDS 100% 13.200 18.480 N Pkd1l3 n/a
4 TRCN0000102866 CGGAGACTGAAAGCGCATTTA pLKO.1 4489 CDS 100% 13.200 10.560 N Pkd1l3 n/a
5 TRCN0000102867 GCCGTGGCTTAACAAAGACAA pLKO.1 4911 CDS 100% 4.950 3.960 N Pkd1l3 n/a
6 TRCN0000102868 CCACTACCTTATCCAGGTCTA pLKO.1 3474 CDS 100% 4.050 2.835 N Pkd1l3 n/a
7 TRCN0000102869 CGTGCAGTTCTTGTGACATTA pLKO.1 4328 CDS 100% 13.200 7.920 N Pkd1l3 n/a
8 TRCN0000155136 CCCAGGATTATCTGTGGCTTT pLKO.1 3893 CDS 100% 4.050 2.835 N PKD1L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.