Transcript: Mouse XM_017312867.1

PREDICTED: Mus musculus calcium channel, voltage-dependent, R type, alpha 1E subunit (Cacna1e), transcript variant X19, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cacna1e (12290)
Length:
8269
CDS:
698..6535

Additional Resources:

NCBI RefSeq record:
XM_017312867.1
NBCI Gene record:
Cacna1e (12290)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000454343 CTGACCTGGCCTACGTTTATT pLKO_005 6231 CDS 100% 15.000 12.000 N Cacna1e n/a
2 TRCN0000068910 CCGGCTCCTAAGGATATTTAA pLKO.1 2860 CDS 100% 15.000 10.500 N Cacna1e n/a
3 TRCN0000450497 GGAGAAGACAGAACCATATTT pLKO_005 1510 CDS 100% 15.000 10.500 N Cacna1e n/a
4 TRCN0000440277 CACCTATGAGCTCGCCTTAAA pLKO_005 5656 CDS 100% 13.200 9.240 N Cacna1e n/a
5 TRCN0000068911 CCCGGCTGGTTATGAATGTAA pLKO.1 1957 CDS 100% 5.625 3.938 N Cacna1e n/a
6 TRCN0000068912 CCTCACCACTTAGATGAGTTT pLKO.1 6356 CDS 100% 4.950 3.465 N Cacna1e n/a
7 TRCN0000068908 CGCTACTTTGAAATGTGCATT pLKO.1 4601 CDS 100% 4.950 3.465 N Cacna1e n/a
8 TRCN0000044720 GCCGCCATTTGAGTACATGAT pLKO.1 1402 CDS 100% 4.950 3.465 N CACNA1E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.