Transcript: Mouse XM_017313067.1

PREDICTED: Mus musculus pleckstrin homology domain containing, family O member 2 (Plekho2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekho2 (102595)
Length:
3309
CDS:
740..1615

Additional Resources:

NCBI RefSeq record:
XM_017313067.1
NBCI Gene record:
Plekho2 (102595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375308 ACAAGGTCAGTGACATCAAAT pLKO_005 405 5UTR 100% 13.200 18.480 N Plekho2 n/a
2 TRCN0000181665 GCAGGTTGATGCCTTCATTAT pLKO.1 2818 3UTR 100% 13.200 18.480 N Plekho2 n/a
3 TRCN0000329160 GCAGGTTGATGCCTTCATTAT pLKO_005 2818 3UTR 100% 13.200 18.480 N Plekho2 n/a
4 TRCN0000329235 GCGGAAACATCACCGCTTTAT pLKO_005 364 5UTR 100% 13.200 18.480 N Plekho2 n/a
5 TRCN0000375359 AGCTGCTGGTCTACGAGAATG pLKO_005 267 5UTR 100% 10.800 7.560 N Plekho2 n/a
6 TRCN0000200223 CTGCCCAAGGAGAAGTTGTAT pLKO.1 1352 CDS 100% 5.625 3.938 N Plekho2 n/a
7 TRCN0000178398 GCTGTAATTAGATGCTCAGAT pLKO.1 2186 3UTR 100% 4.950 3.465 N Plekho2 n/a
8 TRCN0000329159 GCTGTAATTAGATGCTCAGAT pLKO_005 2186 3UTR 100% 4.950 3.465 N Plekho2 n/a
9 TRCN0000182377 GCCACCAACAAGAATCCACTT pLKO.1 586 5UTR 100% 4.050 2.835 N Plekho2 n/a
10 TRCN0000182151 CAAAGCTCTCAACGAAGGGAT pLKO.1 463 5UTR 100% 2.640 1.848 N Plekho2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.