Transcript: Mouse XM_017313159.2

PREDICTED: Mus musculus FYVE and coiled-coil domain containing 1 (Fyco1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fyco1 (17281)
Length:
7944
CDS:
460..4773

Additional Resources:

NCBI RefSeq record:
XM_017313159.2
NBCI Gene record:
Fyco1 (17281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184601 GCCAAGGTGAAAGGAGCAAAT pLKO.1 694 CDS 100% 10.800 7.560 N Fyco1 n/a
2 TRCN0000179990 CCCTGCAACCTTTCTATGAAA pLKO.1 5895 3UTR 100% 5.625 3.938 N Fyco1 n/a
3 TRCN0000178746 CGGGAAGAACAGGTAAACAAT pLKO.1 2161 CDS 100% 5.625 3.938 N Fyco1 n/a
4 TRCN0000038916 CATCTCCTTCAGTGTGGTCTT pLKO.1 4530 CDS 100% 4.050 2.835 N FYCO1 n/a
5 TRCN0000183006 CCTGAATTGTTCTCTAAACAA pLKO.1 1116 CDS 100% 0.563 0.394 N Fyco1 n/a
6 TRCN0000183567 GCAACCTTTCTATGAAAGAAA pLKO.1 5899 3UTR 100% 0.563 0.394 N Fyco1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5503 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313159.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.