Transcript: Mouse XM_017313234.1

PREDICTED: Mus musculus SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (Smarca4), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smarca4 (20586)
Length:
6252
CDS:
3154..5853

Additional Resources:

NCBI RefSeq record:
XM_017313234.1
NBCI Gene record:
Smarca4 (20586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071386 CGCCCGACACATTATTGAGAA pLKO.1 3015 5UTR 100% 4.950 6.930 N Smarca4 n/a
2 TRCN0000288151 CGCCCGACACATTATTGAGAA pLKO_005 3015 5UTR 100% 4.950 6.930 N Smarca4 n/a
3 TRCN0000071384 CCCACGATACAACCAGATGAA pLKO.1 486 5UTR 100% 4.950 3.960 N Smarca4 n/a
4 TRCN0000071387 CGAAGAAGAGTTTGACCTCTT pLKO.1 4836 CDS 100% 0.405 0.324 N Smarca4 n/a
5 TRCN0000288075 CGAAGAAGAGTTTGACCTCTT pLKO_005 4836 CDS 100% 0.405 0.324 N Smarca4 n/a
6 TRCN0000295682 TCGAGTCTCTACCAGCATTAA pLKO_005 6028 3UTR 100% 13.200 9.240 N Smarca4 n/a
7 TRCN0000071385 CGGCTCAAGAAGGAAGTTGAA pLKO.1 3844 CDS 100% 4.950 3.465 N Smarca4 n/a
8 TRCN0000288073 CGGCTCAAGAAGGAAGTTGAA pLKO_005 3844 CDS 100% 4.950 3.465 N Smarca4 n/a
9 TRCN0000071383 GCTGCCAAATACAAACTCAAT pLKO.1 4558 CDS 100% 4.950 3.465 N Smarca4 n/a
10 TRCN0000306805 GCTGCCAAATACAAACTCAAT pLKO_005 4558 CDS 100% 4.950 3.465 N Smarca4 n/a
11 TRCN0000218544 TCAAACAGTACCAGATCAAAG pLKO_005 3170 CDS 100% 10.800 7.560 N SMARCA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.