Transcript: Mouse XM_017313272.1

PREDICTED: Mus musculus transmembrane protease, serine 4 (Tmprss4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmprss4 (214523)
Length:
2083
CDS:
689..1576

Additional Resources:

NCBI RefSeq record:
XM_017313272.1
NBCI Gene record:
Tmprss4 (214523)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031718 CTCAGTCTGTTTCGACAACTT pLKO.1 634 5UTR 100% 4.950 6.930 N Tmprss4 n/a
2 TRCN0000424499 AGTTCTAATGTAAGGTGTATA pLKO_005 1985 3UTR 100% 13.200 9.240 N Tmprss4 n/a
3 TRCN0000434822 GATGAGACAAGGGTATGAAAG pLKO_005 1910 3UTR 100% 10.800 7.560 N Tmprss4 n/a
4 TRCN0000031715 CGGAGGAAAGATGTCTGACAT pLKO.1 1267 CDS 100% 4.950 3.465 N Tmprss4 n/a
5 TRCN0000031717 GCCAAGATCTTCATCGCTGAA pLKO.1 1082 CDS 100% 4.050 2.835 N Tmprss4 n/a
6 TRCN0000031714 CCTTCCACTGAAGGAAGGAAA pLKO.1 1850 3UTR 100% 0.495 0.347 N Tmprss4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.