Transcript: Mouse XM_017313403.1

PREDICTED: Mus musculus 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (Pfkfb4), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pfkfb4 (270198)
Length:
3104
CDS:
485..1354

Additional Resources:

NCBI RefSeq record:
XM_017313403.1
NBCI Gene record:
Pfkfb4 (270198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313403.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225696 CATGACGTTTGCAACCTTAAA pLKO_005 1508 3UTR 100% 13.200 18.480 N Pfkfb4 n/a
2 TRCN0000221725 AGAGCGATGATCTTTAACTTT pLKO.1 286 5UTR 100% 5.625 7.875 N Pfkfb4 n/a
3 TRCN0000218160 GGAAATGACCTACGAAGAAAT pLKO_005 910 CDS 100% 13.200 9.240 N Pfkfb4 n/a
4 TRCN0000218161 GAGCGATGATCTTTAACTTTG pLKO_005 287 5UTR 100% 10.800 7.560 N Pfkfb4 n/a
5 TRCN0000221724 CAGGAGAATGTGTTGGTCATT pLKO.1 1058 CDS 100% 4.950 3.465 N Pfkfb4 n/a
6 TRCN0000196609 GAGAACAGAATGGCTACAAGA pLKO.1 308 5UTR 100% 4.950 3.465 N PFKFB4 n/a
7 TRCN0000221722 CCAGTTCATCAGTGACCAGAA pLKO.1 769 CDS 100% 4.050 2.835 N Pfkfb4 n/a
8 TRCN0000218832 AGGAGAATGTGTTGGTCATTT pLKO_005 1059 CDS 100% 13.200 7.920 N Pfkfb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313403.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.