Transcript: Mouse XM_017313431.1

PREDICTED: Mus musculus F-box and WD-40 domain protein 21 (Fbxw21), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxw21 (320082)
Length:
2286
CDS:
27..1325

Additional Resources:

NCBI RefSeq record:
XM_017313431.1
NBCI Gene record:
Fbxw21 (320082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281613 GGCAACTAACAGCCTGATTTC pLKO_005 575 CDS 100% 10.800 15.120 N Fbxw21 n/a
2 TRCN0000283042 TTCCCGACTTATACCATATTA pLKO_005 685 CDS 100% 15.000 10.500 N Fbxw21 n/a
3 TRCN0000264434 AGAGAAGCCAACAGCTCAATA pLKO_005 1258 CDS 100% 13.200 9.240 N Fbxw21 n/a
4 TRCN0000180770 GAGAAGCCAACAGCTCAATAA pLKO.1 1259 CDS 100% 13.200 9.240 N Fbxw21 n/a
5 TRCN0000264435 TATCGGCTGCAATACAGTAAA pLKO_005 1284 CDS 100% 13.200 9.240 N Fbxw21 n/a
6 TRCN0000283041 TGGACAAGGCAGGTCTGTTAT pLKO_005 368 CDS 100% 13.200 9.240 N Fbxw21 n/a
7 TRCN0000217369 GCTTCTCATTGCAGAACTATG pLKO.1 1033 CDS 100% 10.800 7.560 N Fbxw21 n/a
8 TRCN0000178752 CCAACAGCTCAATAAGTGTTA pLKO.1 1265 CDS 100% 4.950 3.465 N Fbxw21 n/a
9 TRCN0000183213 GCCAGAAGATTTCATTTACAA pLKO.1 278 CDS 100% 5.625 3.375 N Fbxw21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.