Transcript: Mouse XM_017313445.1

PREDICTED: Mus musculus coiled-coil domain containing 33 (Ccdc33), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc33 (382077)
Length:
3301
CDS:
79..3216

Additional Resources:

NCBI RefSeq record:
XM_017313445.1
NBCI Gene record:
Ccdc33 (382077)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242289 TCGGGTAGTTCCCAACTATAC pLKO_005 1416 CDS 100% 10.800 15.120 N Ccdc33 n/a
2 TRCN0000242287 CTTCCACCCATACCAATTTAA pLKO_005 1215 CDS 100% 15.000 10.500 N Ccdc33 n/a
3 TRCN0000242286 ACCACTGAAATCTCGTCTATA pLKO_005 1749 CDS 100% 13.200 9.240 N Ccdc33 n/a
4 TRCN0000242288 GAGAAGATGGAGCAGATATTG pLKO_005 2446 CDS 100% 13.200 9.240 N Ccdc33 n/a
5 TRCN0000189802 GCTCCCTGTAATAAGGAGACT pLKO.1 904 CDS 100% 2.640 1.848 N Ccdc33 n/a
6 TRCN0000201442 CCAATGAACTTTGATGTGCCT pLKO.1 1519 CDS 100% 0.660 0.462 N Ccdc33 n/a
7 TRCN0000242290 CTATCACTGTCACTCTATATG pLKO_005 923 CDS 100% 13.200 7.920 N Ccdc33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.