Transcript: Mouse XM_017313472.1

PREDICTED: Mus musculus taste receptor cell gene 1 (Trcg1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trcg1 (541610)
Length:
2582
CDS:
1..2502

Additional Resources:

NCBI RefSeq record:
XM_017313472.1
NBCI Gene record:
Trcg1 (541610)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313472.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198692 CCACGAAGTGTCAAGATTCTA pLKO.1 1833 CDS 100% 5.625 7.875 N Trcg1 n/a
2 TRCN0000181788 GCCTAGTTCTCAGTCTTGTAT pLKO.1 1779 CDS 100% 5.625 4.500 N Trcg1 n/a
3 TRCN0000219608 CACGCTCTCCCTCCAACATTT pLKO.1 1209 CDS 100% 13.200 9.240 N Trcg1 n/a
4 TRCN0000181313 CCCTTCAGAAATCCAGCATAA pLKO.1 2003 CDS 100% 10.800 7.560 N Trcg1 n/a
5 TRCN0000182648 GACTGACCTTACCCAGGAAAT pLKO.1 1707 CDS 100% 10.800 7.560 N Trcg1 n/a
6 TRCN0000200292 GCACATCAGCTCAGCAAAGTA pLKO.1 146 CDS 100% 5.625 3.938 N Trcg1 n/a
7 TRCN0000198661 CAGACATGAATCTGAGCAGAA pLKO.1 468 CDS 100% 4.050 2.835 N Trcg1 n/a
8 TRCN0000198653 CCATAGAAATCCTCTGGACTT pLKO.1 1601 CDS 100% 4.050 2.835 N Trcg1 n/a
9 TRCN0000182291 GCTCCTATTCAGCAACGTGAA pLKO.1 1881 CDS 100% 4.050 2.835 N Trcg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313472.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.