Transcript: Mouse XM_017313512.1

PREDICTED: Mus musculus coiled-coil domain containing 82 (Ccdc82), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc82 (66396)
Length:
2254
CDS:
197..1753

Additional Resources:

NCBI RefSeq record:
XM_017313512.1
NBCI Gene record:
Ccdc82 (66396)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336232 GTACTTGTCTTACGAACATAA pLKO_005 2126 3UTR 100% 13.200 18.480 N Ccdc82 n/a
2 TRCN0000176660 CATAATGACTTACCAGATGAT pLKO.1 548 CDS 100% 4.950 6.930 N Ccdc82 n/a
3 TRCN0000198231 GCGATGACAGTGATATCCTAA pLKO.1 705 CDS 100% 4.950 6.930 N Ccdc82 n/a
4 TRCN0000197626 CTAGATAGTAATGAGGAACTT pLKO.1 323 CDS 100% 4.950 3.960 N Ccdc82 n/a
5 TRCN0000177236 GACGAGGATGATTACAGATAT pLKO.1 962 CDS 100% 13.200 9.240 N Ccdc82 n/a
6 TRCN0000336231 GACGAGGATGATTACAGATAT pLKO_005 962 CDS 100% 13.200 9.240 N Ccdc82 n/a
7 TRCN0000176964 GAAGCAACAGTAAACATCTTA pLKO.1 477 CDS 100% 5.625 3.938 N Ccdc82 n/a
8 TRCN0000353359 GAAGCAACAGTAAACATCTTA pLKO_005 477 CDS 100% 5.625 3.938 N Ccdc82 n/a
9 TRCN0000197687 GCATCTCACAGTTATTTGATA pLKO.1 291 CDS 100% 5.625 3.938 N Ccdc82 n/a
10 TRCN0000177197 GAAAGTATTGACAGTGATGAA pLKO.1 371 CDS 100% 4.950 3.465 N Ccdc82 n/a
11 TRCN0000177033 GAACAACTGAAGGAAACCAAA pLKO.1 527 CDS 100% 4.950 3.465 N Ccdc82 n/a
12 TRCN0000336293 GAACAACTGAAGGAAACCAAA pLKO_005 527 CDS 100% 4.950 3.465 N Ccdc82 n/a
13 TRCN0000197747 GACGAGAATAGCAATCAACAA pLKO.1 1043 CDS 100% 4.950 3.465 N Ccdc82 n/a
14 TRCN0000177032 GATATTAGCAAGAAGTCTGAT pLKO.1 398 CDS 100% 4.950 3.465 N Ccdc82 n/a
15 TRCN0000198304 GCAGAGAATCATCACAACAGA pLKO.1 587 CDS 100% 3.000 2.100 N Ccdc82 n/a
16 TRCN0000197377 CGAGGATGAATGTTCTTCATT pLKO.1 763 CDS 100% 0.563 0.394 N Ccdc82 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.