Transcript: Mouse XM_017313538.1

PREDICTED: Mus musculus kin of IRRE like 3 (Drosophila) (Kirrel3), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kirrel3 (67703)
Length:
4004
CDS:
657..2969

Additional Resources:

NCBI RefSeq record:
XM_017313538.1
NBCI Gene record:
Kirrel3 (67703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094326 GCTACGTAAAGGAGAGGTCAT pLKO.1 1106 CDS 100% 4.050 5.670 N Kirrel3 n/a
2 TRCN0000094327 CTTCAGGATGATGCCGTGTAT pLKO.1 912 CDS 100% 4.950 3.960 N Kirrel3 n/a
3 TRCN0000094328 TCCAGACCATATACAACTGTA pLKO.1 2035 CDS 100% 4.950 3.465 N Kirrel3 n/a
4 TRCN0000094325 CGGAGAATGAATGAAGGTCAA pLKO.1 675 CDS 100% 4.050 2.835 N Kirrel3 n/a
5 TRCN0000094324 CCACAGCACAATCGAGCTAAT pLKO.1 3723 3UTR 100% 10.800 6.480 N Kirrel3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.