Transcript: Mouse XM_017313567.1

PREDICTED: Mus musculus Rho guanine nucleotide exchange factor (GEF) 12 (Arhgef12), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgef12 (69632)
Length:
9974
CDS:
312..4637

Additional Resources:

NCBI RefSeq record:
XM_017313567.1
NBCI Gene record:
Arhgef12 (69632)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109960 CCGTATTTGAAAGCACACTTT pLKO.1 4986 3UTR 100% 4.950 6.930 N Arhgef12 n/a
2 TRCN0000326987 CCGTATTTGAAAGCACACTTT pLKO_005 4986 3UTR 100% 4.950 6.930 N Arhgef12 n/a
3 TRCN0000109961 GCGGAACAGATCGTTACCAAA pLKO.1 1560 CDS 100% 4.950 6.930 N Arhgef12 n/a
4 TRCN0000326907 GCGGAACAGATCGTTACCAAA pLKO_005 1560 CDS 100% 4.950 6.930 N Arhgef12 n/a
5 TRCN0000109962 GCCATCAGTCACTGGACATAT pLKO.1 488 CDS 100% 13.200 9.240 N Arhgef12 n/a
6 TRCN0000326908 GCCATCAGTCACTGGACATAT pLKO_005 488 CDS 100% 13.200 9.240 N Arhgef12 n/a
7 TRCN0000109964 GCAGTATGTAATTCTCATGTA pLKO.1 1637 CDS 100% 4.950 3.465 N Arhgef12 n/a
8 TRCN0000326920 GCAGTATGTAATTCTCATGTA pLKO_005 1637 CDS 100% 4.950 3.465 N Arhgef12 n/a
9 TRCN0000109963 CCTCAGTCTCATTCACTGAAT pLKO.1 3579 CDS 100% 0.495 0.347 N Arhgef12 n/a
10 TRCN0000326911 CCTCAGTCTCATTCACTGAAT pLKO_005 3579 CDS 100% 0.495 0.347 N Arhgef12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.