Transcript: Mouse XM_017313608.1

PREDICTED: Mus musculus N-acetylated alpha-linked acidic dipeptidase 2 (Naalad2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Naalad2 (72560)
Length:
2914
CDS:
184..2520

Additional Resources:

NCBI RefSeq record:
XM_017313608.1
NBCI Gene record:
Naalad2 (72560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032226 CGCTACACTAAGAACAAGAAA pLKO.1 1873 CDS 100% 5.625 4.500 N Naalad2 n/a
2 TRCN0000032225 CCTGTATATCATACCATCTAT pLKO.1 1915 CDS 100% 5.625 3.938 N Naalad2 n/a
3 TRCN0000032228 GCTTCTTGAAAGAGCATTCAT pLKO.1 2274 CDS 100% 5.625 3.938 N Naalad2 n/a
4 TRCN0000032224 GCAGTGTCATTTGATCCCTTA pLKO.1 2143 CDS 100% 4.050 2.835 N Naalad2 n/a
5 TRCN0000032227 GCAGAAGTGAAGAAACATATT pLKO.1 2443 CDS 100% 13.200 7.920 N Naalad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313608.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.