Transcript: Mouse XM_017313675.1

PREDICTED: Mus musculus RIKEN cDNA 4930563M21 gene (4930563M21Rik), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
4930563M21Rik (75258)
Length:
2137
CDS:
368..1981

Additional Resources:

NCBI RefSeq record:
XM_017313675.1
NBCI Gene record:
4930563M21Rik (75258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217451 GCACACCTTTGAACTTGATAC pLKO.1 1813 CDS 100% 10.800 15.120 N 4930563M21Rik n/a
2 TRCN0000181486 CCATTCCTAACTTGGAGAGAT pLKO.1 1907 CDS 100% 4.950 3.465 N 4930563M21Rik n/a
3 TRCN0000177990 GCACTGATGATGATTTGGATA pLKO.1 1695 CDS 100% 4.950 3.465 N 4930563M21Rik n/a
4 TRCN0000182800 CCTATACAGGAGGACAAGGAT pLKO.1 1874 CDS 100% 3.000 2.100 N 4930563M21Rik n/a
5 TRCN0000198887 GATCATGTGGATGATGACGAT pLKO.1 1718 CDS 100% 0.264 0.185 N 4930563M21Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.