Transcript: Mouse XM_017313763.1

PREDICTED: Mus musculus sine oculis-binding protein homolog (Drosophila) (Sobp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sobp (109205)
Length:
5271
CDS:
835..3333

Additional Resources:

NCBI RefSeq record:
XM_017313763.1
NBCI Gene record:
Sobp (109205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219553 TGCCAAGAGAACTCGGTAAAT pLKO.1 4112 3UTR 100% 13.200 18.480 N Sobp n/a
2 TRCN0000432434 TGGAATATCCCGCTAACAGAT pLKO_005 1636 CDS 100% 4.950 6.930 N SOBP n/a
3 TRCN0000180124 CGGAGGACAGTGTTATTTCAT pLKO.1 1097 CDS 100% 5.625 4.500 N Sobp n/a
4 TRCN0000172730 GAGGTGCCTCCGAATTAGAAA pLKO.1 3300 CDS 100% 5.625 4.500 N SOBP n/a
5 TRCN0000219552 CCATGGCAATGTGCCTATTAT pLKO.1 1194 CDS 100% 15.000 10.500 N Sobp n/a
6 TRCN0000167050 CCTGTCATGGTTAAGAGAAAT pLKO.1 4446 3UTR 100% 13.200 9.240 N SOBP n/a
7 TRCN0000219551 TGGCTGGTATGGCTATGATAA pLKO.1 963 CDS 100% 13.200 9.240 N Sobp n/a
8 TRCN0000195822 CCACCCTCACATGGAAAGTAA pLKO.1 1575 CDS 100% 5.625 3.938 N Sobp n/a
9 TRCN0000434130 ACAAGGACCAATGTAGGTATT pLKO_005 3666 3UTR 100% 10.800 15.120 N SOBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313763.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.