Transcript: Mouse XM_017313764.1

PREDICTED: Mus musculus sine oculis-binding protein homolog (Drosophila) (Sobp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sobp (109205)
Length:
3936
CDS:
181..1998

Additional Resources:

NCBI RefSeq record:
XM_017313764.1
NBCI Gene record:
Sobp (109205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219553 TGCCAAGAGAACTCGGTAAAT pLKO.1 2777 3UTR 100% 13.200 18.480 N Sobp n/a
2 TRCN0000432434 TGGAATATCCCGCTAACAGAT pLKO_005 301 CDS 100% 4.950 6.930 N SOBP n/a
3 TRCN0000172730 GAGGTGCCTCCGAATTAGAAA pLKO.1 1965 CDS 100% 5.625 4.500 N SOBP n/a
4 TRCN0000219552 CCATGGCAATGTGCCTATTAT pLKO.1 11 5UTR 100% 15.000 10.500 N Sobp n/a
5 TRCN0000167050 CCTGTCATGGTTAAGAGAAAT pLKO.1 3111 3UTR 100% 13.200 9.240 N SOBP n/a
6 TRCN0000195822 CCACCCTCACATGGAAAGTAA pLKO.1 240 CDS 100% 5.625 3.938 N Sobp n/a
7 TRCN0000434130 ACAAGGACCAATGTAGGTATT pLKO_005 2331 3UTR 100% 10.800 15.120 N SOBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313764.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.