Transcript: Mouse XM_017313934.1

PREDICTED: Mus musculus predicted gene 4922 (Gm4922), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm4922 (237300)
Length:
2352
CDS:
356..1849

Additional Resources:

NCBI RefSeq record:
XM_017313934.1
NBCI Gene record:
Gm4922 (237300)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362227 GTCAGGATGATGGCAATTATG pLKO_005 1359 CDS 100% 13.200 18.480 N Gm4922 n/a
2 TRCN0000362149 GGCCTGTTATTGGCAACAAAC pLKO_005 1112 CDS 100% 10.800 15.120 N Gm4922 n/a
3 TRCN0000362228 GATGAAGCAAGAAGCATATTT pLKO_005 716 CDS 100% 15.000 10.500 N Gm4922 n/a
4 TRCN0000362225 GGACATTAGAGAATCATTAAA pLKO_005 1282 CDS 100% 15.000 10.500 N Gm4922 n/a
5 TRCN0000024238 CATGTCAGGATGATGGCAATT pLKO.1 1356 CDS 100% 10.800 7.560 N Gm4922 n/a
6 TRCN0000024237 CCAGTTCATTCCTCCAGAGAT pLKO.1 907 CDS 100% 4.950 3.465 N Gm4922 n/a
7 TRCN0000024234 GCACTACTGAAGTGAGGCTAT pLKO.1 468 CDS 100% 4.050 2.835 N Gm4922 n/a
8 TRCN0000024235 GCTCAGCATGTTTGAGGAGAA pLKO.1 400 CDS 100% 4.050 2.835 N Gm4922 n/a
9 TRCN0000024236 GACATTGTGTTGCTGCACGTT pLKO.1 1786 CDS 100% 2.640 1.848 N Gm4922 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.