Transcript: Mouse XM_017313997.1

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2 (Ppfia2), transcript variant X36, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppfia2 (327814)
Length:
5210
CDS:
236..3781

Additional Resources:

NCBI RefSeq record:
XM_017313997.1
NBCI Gene record:
Ppfia2 (327814)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109798 GCACTGACTAAAGAGTTGAAT pLKO.1 326 CDS 100% 5.625 7.875 N Ppfia2 n/a
2 TRCN0000109796 GCCCAAATGAAAGAACGCTTA pLKO.1 866 CDS 100% 4.050 3.240 N Ppfia2 n/a
3 TRCN0000426770 AGAGCATCATCTACGTCATAA pLKO_005 4019 3UTR 100% 13.200 9.240 N Ppfia2 n/a
4 TRCN0000419929 GTGGAGCAATGATCGAGTTAT pLKO_005 3328 CDS 100% 13.200 9.240 N Ppfia2 n/a
5 TRCN0000109797 CCACAATTAAATGCGAGACTT pLKO.1 2325 CDS 100% 4.950 3.465 N Ppfia2 n/a
6 TRCN0000109799 CCACTATATCAAGAACTCATA pLKO.1 1650 CDS 100% 4.950 3.465 N Ppfia2 n/a
7 TRCN0000109795 GCCAGACTCAAGTCTGTTATT pLKO.1 4785 3UTR 100% 1.320 0.924 N Ppfia2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.