Transcript: Mouse XM_017314053.1

PREDICTED: Mus musculus required for meiotic nuclear division 1 homolog (Rmnd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rmnd1 (66084)
Length:
1998
CDS:
345..1697

Additional Resources:

NCBI RefSeq record:
XM_017314053.1
NBCI Gene record:
Rmnd1 (66084)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135730 CGAAGAGTTAAGGTCATGAAT pLKO.1 1536 CDS 100% 5.625 3.375 N RMND1 n/a
2 TRCN0000190582 GCCTAGAGATGCAGCAAATAT pLKO.1 953 CDS 100% 15.000 7.500 Y Rmnd1 n/a
3 TRCN0000250533 GTCCATTCCAGAGGCATTAAA pLKO_005 1337 CDS 100% 15.000 7.500 Y Rmnd1 n/a
4 TRCN0000250532 ACTCATTCTTTCCAAGTATAA pLKO_005 499 CDS 100% 13.200 6.600 Y Rmnd1 n/a
5 TRCN0000250530 GCAGACTCTTTCCGTTAAATG pLKO_005 580 CDS 100% 13.200 6.600 Y Rmnd1 n/a
6 TRCN0000250529 TTGCCCTCAGGCACCGAATAA pLKO_005 1417 CDS 100% 13.200 6.600 Y Rmnd1 n/a
7 TRCN0000250531 ACTCTTACTCTACCCTCTAAG pLKO_005 1777 3UTR 100% 10.800 5.400 Y Rmnd1 n/a
8 TRCN0000190813 GCATGGAACTAACAGACCTAA pLKO.1 1573 CDS 100% 4.950 2.475 Y Rmnd1 n/a
9 TRCN0000189742 GCCGGATAACATCAGACACAA pLKO.1 559 CDS 100% 4.950 2.475 Y Rmnd1 n/a
10 TRCN0000217113 CCTCATCACCATTGAGGTAAT pLKO.1 1649 CDS 100% 1.080 0.540 Y Rmnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.