Transcript: Mouse XM_017314113.1

PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 2 (Cnot2), transcript variant X19, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnot2 (72068)
Length:
2279
CDS:
192..1244

Additional Resources:

NCBI RefSeq record:
XM_017314113.1
NBCI Gene record:
Cnot2 (72068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375964 TGACGACAGCAAATCTAATTT pLKO_005 506 CDS 100% 15.000 21.000 N Cnot2 n/a
2 TRCN0000238810 TTACCTGGTTCCAGCTATAAA pLKO_005 468 CDS 100% 15.000 21.000 N Cnot2 n/a
3 TRCN0000233435 GTGAAGATCCTTCTCGTATTT pLKO_005 1665 3UTR 100% 13.200 18.480 N Cnot2 n/a
4 TRCN0000234899 GTGAAGATCCTTCTCGTATTT pLKO_005 1665 3UTR 100% 13.200 18.480 N CNOT2 n/a
5 TRCN0000233433 AGCGTTAGCTGACCGGAATAG pLKO_005 314 CDS 100% 10.800 15.120 N Cnot2 n/a
6 TRCN0000103582 CGAGTTACTAACATTCCTCAA pLKO.1 645 CDS 100% 4.050 5.670 N Cnot2 n/a
7 TRCN0000103584 CGGCAACCCAACTCCATTAAT pLKO.1 347 CDS 100% 15.000 12.000 N Cnot2 n/a
8 TRCN0000233432 ACTCCTTATCAAGTAACATTT pLKO_005 238 CDS 100% 13.200 10.560 N Cnot2 n/a
9 TRCN0000234895 ACTCCTTATCAAGTAACATTT pLKO_005 238 CDS 100% 13.200 10.560 N CNOT2 n/a
10 TRCN0000233434 CTCAATACACAACGAAGATTT pLKO_005 440 CDS 100% 13.200 10.560 N Cnot2 n/a
11 TRCN0000103581 GCAATCAAACTTGGCCGATAT pLKO.1 918 CDS 100% 10.800 8.640 N Cnot2 n/a
12 TRCN0000103580 GCATTGTTCATTGTAGCACTA pLKO.1 1608 3UTR 100% 4.050 3.240 N Cnot2 n/a
13 TRCN0000375884 CCATGTTCCATCAGAATATTT pLKO_005 866 CDS 100% 15.000 10.500 N Cnot2 n/a
14 TRCN0000375965 GGTCCTGCCTTACCAATTATG pLKO_005 1386 3UTR 100% 13.200 9.240 N Cnot2 n/a
15 TRCN0000015131 CCGTGATTGGAGATACCACAA pLKO.1 1019 CDS 100% 4.050 2.835 N CNOT2 n/a
16 TRCN0000103583 CCTTTCAGATTTCCCAGCGTT pLKO.1 299 CDS 100% 2.640 1.848 N Cnot2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.