Transcript: Mouse XM_017314121.1

PREDICTED: Mus musculus signal peptide peptidase like 2B (Sppl2b), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sppl2b (73218)
Length:
2256
CDS:
321..1190

Additional Resources:

NCBI RefSeq record:
XM_017314121.1
NBCI Gene record:
Sppl2b (73218)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430072 GCCTGGTCTACGTGATCATTG pLKO_005 203 5UTR 100% 10.800 15.120 N Sppl2b n/a
2 TRCN0000030535 CCAGTCATGATCTGCGTGTTT pLKO.1 133 5UTR 100% 4.950 6.930 N Sppl2b n/a
3 TRCN0000030534 CCACTGCTCTAAGCCAGTAAA pLKO.1 1644 3UTR 100% 13.200 9.240 N Sppl2b n/a
4 TRCN0000438760 TCTGAGGCCTCAAGTAGATTC pLKO_005 1336 3UTR 100% 10.800 7.560 N Sppl2b n/a
5 TRCN0000429490 CCCAACAAGCAGGTTCCTATG pLKO_005 1525 3UTR 100% 6.000 4.200 N Sppl2b n/a
6 TRCN0000030536 GCAGTCCTCCAGAATTTACTT pLKO.1 749 CDS 100% 5.625 3.938 N Sppl2b n/a
7 TRCN0000030537 GCCTACTGTCACAGGTTTGAT pLKO.1 720 CDS 100% 5.625 3.938 N Sppl2b n/a
8 TRCN0000429102 AGAAGTACATGAAGCATAAGC pLKO_005 65 5UTR 100% 4.950 3.465 N Sppl2b n/a
9 TRCN0000430577 AGGAGAGTCCATGCCAAGATG pLKO_005 1607 3UTR 100% 4.950 3.465 N Sppl2b n/a
10 TRCN0000030538 GCTTGTGCTTCTCTACTACTT pLKO.1 174 5UTR 100% 4.950 3.465 N Sppl2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.