Transcript: Mouse XM_017314124.1

PREDICTED: Mus musculus zinc finger protein 433 (Zfp433), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp433 (73610)
Length:
2475
CDS:
261..1967

Additional Resources:

NCBI RefSeq record:
XM_017314124.1
NBCI Gene record:
Zfp433 (73610)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239864 ACGTAGCAGCGCTCTTCTAAT pLKO_005 764 CDS 100% 13.200 7.920 N Zfp433 n/a
2 TRCN0000239865 CTTGCACAACAAGCATATTAT pLKO_005 2298 3UTR 100% 15.000 7.500 Y Zfp433 n/a
3 TRCN0000239866 ACGTCGCAGTCACCTTCATAT pLKO_005 1352 CDS 100% 13.200 6.600 Y Zfp433 n/a
4 TRCN0000239867 AGAAGACATAGAAGGTATAAC pLKO_005 342 CDS 100% 13.200 6.600 Y Zfp433 n/a
5 TRCN0000239754 GAGAAACCTTATGAGTGTAAT pLKO_005 1059 CDS 100% 13.200 6.600 Y Gm11677 n/a
6 TRCN0000239863 TATGGAAAGAACCAATATATC pLKO_005 402 CDS 100% 13.200 6.600 Y Zfp433 n/a
7 TRCN0000235189 AGTCGTAGTAGTCTTCGAAAT pLKO_005 1857 CDS 100% 10.800 5.400 Y Gm4767 n/a
8 TRCN0000235208 AGTCGTAGTAGTCTTCGAAAT pLKO_005 1857 CDS 100% 10.800 5.400 Y EG666477 n/a
9 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 716 CDS 100% 13.200 6.600 Y Gm14305 n/a
10 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 715 CDS 100% 10.800 5.400 Y Gm14308 n/a
11 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 886 CDS 100% 5.625 2.813 Y ZNF345 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.