Transcript: Mouse XM_017314176.1

PREDICTED: Mus musculus complement component (3b/4b) receptor 1-like (Cr1l), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cr1l (12946)
Length:
1368
CDS:
152..1294

Additional Resources:

NCBI RefSeq record:
XM_017314176.1
NBCI Gene record:
Cr1l (12946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101256 CGCTCAATCAGTGGTCTAATT pLKO.1 1043 CDS 100% 13.200 18.480 N Cr1l n/a
2 TRCN0000423631 GAGAGGGAAGGCGCTCTTTAA pLKO_005 565 CDS 100% 13.200 18.480 N Cr1l n/a
3 TRCN0000437497 GGGATACTGAGGCACCTATTT pLKO_005 429 CDS 100% 13.200 18.480 N Cr1l n/a
4 TRCN0000418546 AGTATAAAGAAGTGGGTATTC pLKO_005 1161 CDS 100% 10.800 8.640 N Cr1l n/a
5 TRCN0000433416 GTTTCCCATTGGAACATATTT pLKO_005 154 CDS 100% 15.000 10.500 N Cr1l n/a
6 TRCN0000101257 CCAATGGAGATTTCTTCAGTT pLKO.1 486 CDS 100% 4.950 3.465 N Cr1l n/a
7 TRCN0000101255 CGAGTGCTGAAGATAAGTGTA pLKO.1 246 CDS 100% 4.950 3.465 N Cr1l n/a
8 TRCN0000101259 GAGAGAATGTAACCTTGGAAT pLKO.1 933 CDS 100% 4.950 3.465 N Cr1l n/a
9 TRCN0000101258 CATTCCCAATGGAGATTTCTT pLKO.1 481 CDS 100% 5.625 3.375 N Cr1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.