Transcript: Mouse XM_017314207.1

PREDICTED: Mus musculus proteasome (prosome, macropain) activator subunit 4 (Psme4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Psme4 (103554)
Length:
5267
CDS:
256..5124

Additional Resources:

NCBI RefSeq record:
XM_017314207.1
NBCI Gene record:
Psme4 (103554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314207.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178428 GCGGAAACTCTCCACTTATAT pLKO.1 483 CDS 100% 15.000 21.000 N Psme4 n/a
2 TRCN0000278651 GCGGAAACTCTCCACTTATAT pLKO_005 483 CDS 100% 15.000 21.000 N Psme4 n/a
3 TRCN0000176569 CGACTTTAGTAAGTGCATGAT pLKO.1 1740 CDS 100% 4.950 6.930 N Psme4 n/a
4 TRCN0000278715 CGACTTTAGTAAGTGCATGAT pLKO_005 1740 CDS 100% 4.950 6.930 N Psme4 n/a
5 TRCN0000177369 GCCATCAATAGTGAGACTATT pLKO.1 3462 CDS 100% 1.320 1.848 N Psme4 n/a
6 TRCN0000278714 GCCATCAATAGTGAGACTATT pLKO_005 3462 CDS 100% 1.320 1.848 N Psme4 n/a
7 TRCN0000217888 GCACTTCCAAGGATCTCATAA pLKO.1 2958 CDS 100% 13.200 9.240 N Psme4 n/a
8 TRCN0000217517 GCGTTGGCTGAACAAGTTAAT pLKO.1 1296 CDS 100% 13.200 9.240 N Psme4 n/a
9 TRCN0000197460 CCACTTTATGACTTGGTAGAA pLKO.1 685 CDS 100% 4.950 3.465 N Psme4 n/a
10 TRCN0000278713 CCACTTTATGACTTGGTAGAA pLKO_005 685 CDS 100% 4.950 3.465 N Psme4 n/a
11 TRCN0000156489 CGGTTGCCAAACAGTGTTGTT pLKO.1 1330 CDS 100% 4.950 3.465 N PSME4 n/a
12 TRCN0000198864 GCGGCCTTTAATGTGTCCTTT pLKO.1 843 CDS 100% 4.950 3.465 N Psme4 n/a
13 TRCN0000198456 GCAAAGAAATCTGCCTTGGAA pLKO.1 3720 CDS 100% 3.000 2.100 N Psme4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314207.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.