Transcript: Mouse XM_017314299.1

PREDICTED: Mus musculus integrin alpha E, epithelial-associated (Itgae), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itgae (16407)
Length:
4280
CDS:
114..3227

Additional Resources:

NCBI RefSeq record:
XM_017314299.1
NBCI Gene record:
Itgae (16407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439890 CCCTGTATCGATGCGCTATAT pLKO_005 316 CDS 100% 13.200 18.480 N Itgae n/a
2 TRCN0000436806 GTGTCCGGTGGGTTAGATTTC pLKO_005 2031 CDS 100% 10.800 15.120 N Itgae n/a
3 TRCN0000066404 CGCAGCCTTCAATTCAGACAT pLKO.1 2949 CDS 100% 4.950 3.960 N Itgae n/a
4 TRCN0000066407 CCTTAGAGAGATGTTCCTCAA pLKO.1 2243 CDS 100% 4.050 3.240 N Itgae n/a
5 TRCN0000416492 CTTACTGATGGTGACATATTT pLKO_005 1020 CDS 100% 15.000 10.500 N Itgae n/a
6 TRCN0000066405 CCACACTTTCAAGGTGACCAA pLKO.1 1184 CDS 100% 2.640 1.848 N Itgae n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.