Transcript: Mouse XM_017314303.1

PREDICTED: Mus musculus CD55 molecule, decay accelerating factor for complement (Cd55), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd55 (13136)
Length:
8294
CDS:
338..1510

Additional Resources:

NCBI RefSeq record:
XM_017314303.1
NBCI Gene record:
Cd55 (13136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314303.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067575 GTCATCCAATAAGAACATCTA pLKO.1 1377 CDS 100% 4.950 6.930 N Cd55 n/a
2 TRCN0000419225 GTTAGTCTAGCTTATGATTAA pLKO_005 1854 3UTR 100% 13.200 9.240 N Cd55 n/a
3 TRCN0000067573 CCCAACGAAGAAACCAACAAT pLKO.1 1207 CDS 100% 5.625 3.938 N Cd55 n/a
4 TRCN0000067577 GTCACAGGAAATACTGTTGAT pLKO.1 953 CDS 100% 4.950 3.465 N Cd55 n/a
5 TRCN0000067576 CCTGGTTGGAAATGCTAGCAT pLKO.1 1111 CDS 100% 3.000 2.100 N Cd55 n/a
6 TRCN0000427681 ACATAGCCAACGAAGAGTTAC pLKO_005 1505 CDS 100% 10.800 6.480 N Cd55 n/a
7 TRCN0000067574 CCTGTTACCAAGACAACAGTA pLKO.1 1355 CDS 100% 0.495 0.248 Y Cd55 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314303.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.