Transcript: Mouse XM_017314351.1

PREDICTED: Mus musculus integrin beta 4 (Itgb4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itgb4 (192897)
Length:
6276
CDS:
436..6042

Additional Resources:

NCBI RefSeq record:
XM_017314351.1
NBCI Gene record:
Itgb4 (192897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066877 CGTGGATCTGTATATCCTCAT pLKO.1 825 CDS 100% 4.050 5.670 N Itgb4 n/a
2 TRCN0000066873 CCACCGTTATTCTCGATGAAA pLKO.1 3734 CDS 100% 5.625 7.313 N Itgb4 n/a
3 TRCN0000066874 CGACTGCACTTACAGCTACAA pLKO.1 2475 CDS 100% 4.950 3.960 N Itgb4 n/a
4 TRCN0000066875 GCAGGAGGATTCATCCAACAT pLKO.1 1482 CDS 100% 4.950 3.960 N Itgb4 n/a
5 TRCN0000066876 CGGATGCTGCTCATTGAGAAT pLKO.1 4273 CDS 100% 4.950 3.465 N Itgb4 n/a
6 TRCN0000057772 CGAGGTCACATGGTGGGCTTT pLKO.1 2692 CDS 100% 1.350 0.945 N ITGB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.