Transcript: Mouse XM_017314515.1

PREDICTED: Mus musculus echinoderm microtubule associated protein like 6 (Eml6), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eml6 (237711)
Length:
8124
CDS:
670..6618

Additional Resources:

NCBI RefSeq record:
XM_017314515.1
NBCI Gene record:
Eml6 (237711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314515.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174438 CCTAACCAATATGTAGCGTTT pLKO.1 6895 3UTR 100% 4.050 5.670 N Eml6 n/a
2 TRCN0000216064 CAACTGACTAATCAATGATAT pLKO.1 7937 3UTR 100% 13.200 9.240 N Eml6 n/a
3 TRCN0000216325 GATGATTAATGCAGGGTAAAT pLKO.1 7413 3UTR 100% 13.200 9.240 N Eml6 n/a
4 TRCN0000370841 TGGGACACAACGACGACATTA pLKO_005 842 CDS 100% 13.200 9.240 N EML6 n/a
5 TRCN0000193265 CAGTTGACTTCTATGACCTTA pLKO.1 6119 CDS 100% 4.950 3.465 N Eml6 n/a
6 TRCN0000174738 GAAACTGTTAAACAAGGTGAA pLKO.1 5898 CDS 100% 4.050 2.835 N Eml6 n/a
7 TRCN0000194452 GCTTATTGTGACTGGCGGAAA pLKO.1 5565 CDS 100% 4.050 2.835 N Eml6 n/a
8 TRCN0000194111 GAAGCAAGTAACTGAAGCCAT pLKO.1 6282 CDS 100% 2.640 1.848 N Eml6 n/a
9 TRCN0000042897 GCCCGAGAAACTCCAGAAGTT pLKO.1 4773 CDS 100% 4.950 2.970 N SLC6A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314515.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.