Transcript: Mouse XM_017314553.1

PREDICTED: Mus musculus CD300 molecule like family member F (Cd300lf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd300lf (246746)
Length:
2418
CDS:
645..1658

Additional Resources:

NCBI RefSeq record:
XM_017314553.1
NBCI Gene record:
Cd300lf (246746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412399 CGTATCAACGATGACAATAAT pLKO_005 1907 3UTR 100% 15.000 21.000 N Cd300lf n/a
2 TRCN0000100038 AGGAGCCTACTTATGGCAATA pLKO.1 1540 CDS 100% 10.800 15.120 N Cd300lf n/a
3 TRCN0000100039 CTGACTAGCTACTACTCTGAT pLKO.1 1134 CDS 100% 4.950 3.960 N Cd300lf n/a
4 TRCN0000438208 GGCTTGGAGCATGGATCTTTA pLKO_005 1676 3UTR 100% 13.200 9.240 N Cd300lf n/a
5 TRCN0000425645 TTCATCCTCATACCCATAATC pLKO_005 1991 3UTR 100% 13.200 9.240 N Cd300lf n/a
6 TRCN0000100036 CCAGCAATCCAAGTACCCATT pLKO.1 1026 CDS 100% 4.050 2.835 N Cd300lf n/a
7 TRCN0000416711 GACAGTGCAGTGCCGATATAC pLKO_005 755 CDS 100% 13.200 7.920 N Cd300lf n/a
8 TRCN0000100035 GCCTCTGTACCTGCTTCCTTA pLKO.1 1702 3UTR 100% 4.950 2.970 N Cd300lf n/a
9 TRCN0000439453 ATGAGCGATGCTGGCATTTAC pLKO_005 945 CDS 100% 13.200 6.600 Y Cd300lf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.