Transcript: Mouse XM_017314565.1

PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF)-like 1 (Rapgefl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rapgefl1 (268480)
Length:
3174
CDS:
91..1365

Additional Resources:

NCBI RefSeq record:
XM_017314565.1
NBCI Gene record:
Rapgefl1 (268480)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254219 GGAACGGACCTTGTATCATAT pLKO_005 2696 3UTR 100% 13.200 18.480 N Rapgefl1 n/a
2 TRCN0000254217 GTATCAACAGCCACCTATTTG pLKO_005 539 CDS 100% 13.200 18.480 N Rapgefl1 n/a
3 TRCN0000254218 CAAGAACCTGTTCCGTAAATT pLKO_005 999 CDS 100% 15.000 10.500 N Rapgefl1 n/a
4 TRCN0000254216 GTAGATGGTCTGGTGAATATT pLKO_005 1156 CDS 100% 15.000 10.500 N Rapgefl1 n/a
5 TRCN0000047578 GCCAGGGAAATTCAAGAACTT pLKO.1 987 CDS 100% 4.950 2.970 N RAPGEFL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.