Transcript: Mouse XM_017314586.1

PREDICTED: Mus musculus smoothelin (Smtn), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smtn (29856)
Length:
3179
CDS:
253..3024

Additional Resources:

NCBI RefSeq record:
XM_017314586.1
NBCI Gene record:
Smtn (29856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306196 CAAGAATGTCTAGCCACTCTG pLKO_005 3012 CDS 100% 4.050 5.670 N Smtn n/a
2 TRCN0000112951 CCGACGCCAGAACTTTGAAAT pLKO.1 2835 CDS 100% 13.200 10.560 N Smtn n/a
3 TRCN0000326418 CCGACGCCAGAACTTTGAAAT pLKO_005 2835 CDS 100% 13.200 10.560 N Smtn n/a
4 TRCN0000112952 GCAGTATGAAGACTACGTTTA pLKO.1 1610 CDS 100% 10.800 7.560 N Smtn n/a
5 TRCN0000326345 GCAGTATGAAGACTACGTTTA pLKO_005 1610 CDS 100% 10.800 7.560 N Smtn n/a
6 TRCN0000112953 CGCCAATAGCATCAAGCAGAT pLKO.1 2661 CDS 100% 4.050 2.835 N Smtn n/a
7 TRCN0000326343 CGCCAATAGCATCAAGCAGAT pLKO_005 2661 CDS 100% 4.050 2.835 N Smtn n/a
8 TRCN0000112950 GACATGATGATCATGGGCAAA pLKO.1 2911 CDS 100% 4.050 2.835 N Smtn n/a
9 TRCN0000112954 CCAGACTACGAACTTTGAGGA pLKO.1 2037 CDS 100% 2.640 1.848 N Smtn n/a
10 TRCN0000326420 CCAGACTACGAACTTTGAGGA pLKO_005 2037 CDS 100% 2.640 1.848 N Smtn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.