Transcript: Mouse XM_017314595.1

PREDICTED: Mus musculus EF-hand calcium binding domain 5 (Efcab5), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Efcab5 (319634)
Length:
6138
CDS:
1107..5744

Additional Resources:

NCBI RefSeq record:
XM_017314595.1
NBCI Gene record:
Efcab5 (319634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215995 CTTACCTCATGAGATCAAATT pLKO.1 4634 CDS 100% 13.200 18.480 N Efcab5 n/a
2 TRCN0000178650 CCAGCGGAATACGTAATAGAA pLKO.1 5945 3UTR 100% 5.625 7.875 N Efcab5 n/a
3 TRCN0000176710 CGGAATACGTAATAGAATGTA pLKO.1 5949 3UTR 100% 5.625 7.875 N Efcab5 n/a
4 TRCN0000198276 GAATGAGTATAACGGGTCGTT pLKO.1 4523 CDS 100% 2.640 3.696 N Efcab5 n/a
5 TRCN0000216906 GAGCTCGTTACAAGCTATATC pLKO.1 5526 CDS 100% 13.200 10.560 N Efcab5 n/a
6 TRCN0000176517 CATGGATATTAAGAAGCACAT pLKO.1 2189 CDS 100% 4.050 3.240 N Efcab5 n/a
7 TRCN0000178681 CAGACCTACATGCGACTATTA pLKO.1 3598 CDS 100% 13.200 9.240 N Efcab5 n/a
8 TRCN0000178369 GCATGCATTGATGATGACCAT pLKO.1 5913 3UTR 100% 2.640 1.848 N Efcab5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.